【正文】
isplatin and 5fluorouracil than negative control and parent cells (Figs. 7A, 6B). The number of apoptotic cells induced by cisplatin and 5fluorouracil increased to about 168。175。193。bactinupstream,50AGCGCAAGTACTCCGTGTG30。CPCR as a negative control. Sequences of livin and βactin primers used are as follows:livina/b up stream,50TCCACAGTGTGCAGGAGACT30。C14]. It has been shown that overexpression of the livin can block apoptosis induced by a variety of proapoptotic stimuli [12]. Interestingly, livin gene has been found to be restrictively expressed in tumor cells, but not, or to lesser amounts in most normal adult tissues [11168。 Expression of livin in gastric cancer and induction of apoptosis in SGC7901 cells by shRNAmediated silencing of livin gene BackgroundBecause of increased resistance to apoptosis in tumor cells, inhibition of specific antiapoptotic factors may provide a rational approach for the development of novel therapeutic , a novel inhibitor of apoptosis protein family, has been found to be expressed in various malignancies and is suggested to have poorly prognostic significance. However, no data are available concerning the significance of livin in gastric cancer. In this study, we detected the expression of livin in human gastric carcinoma and investigated the apoptotic susceptibility of SGC7901 cell by shRNAmediated silencing of the livin gene. MethodsThe mRNA and protein expression of livin were analyzed by RTPCR and western blot relationship between livin expression and clinical pathologic parameters was investigated. The small interfering RNA eukaryotic expression vector specific to livin was constructed by gene rebination, and the nucleic acid was sequenced. Then it was transfected into SGC7901 cells by Lipofectamin 2000. RTPCR and Western blot assay were used to validate genesilencing efficiency of livin in SGC7901 cells. Stable clones were obtained by G418 screening. The cell apoptosis was assessed by flow cytometry (FCM). Cell growth state and 50 % inhibition concentration (IC50) of 5FU and cisplatin was determined by MTT method. ResultsThe expression of livin mRNA and protein were detected in 19 of 40 gastric carcinoma cases (%) and SGC7901 cells. No expression of livin was detected in tumor adjacent tissues and benign gastric lesion. The positive correlation was found between livin expression and poor differentiation of tumors as well as lymph node metastases (P ). Four small interfering RNA eukaryotic expressionvector specific to livin were constructed by gene rebination. And one of them can efficiently decrease the expression of livin, the inhibition of the gene was not less than 70% (P ). The rebinated plasmids were extracted and transfected gastric cancer cells. The stable clones were obtained by G418 screening, and were amplified and cultured. When livin gene was silenced, the reproductive activity of the gastric cancer cells was significantly lower than the control groups(P ). The study also showed that IC50 of 5Fu and cisplatin on gastric cancer cells treated by shRNA was decreased and the cells were more susceptible to proapoptotic stimuli (5Fu and cisplatin) (P ). ConclusionsC Livin is overexpressed in gastric carcinoma with a relationship to tumor differentiation and lymph node metastases, which is suggested to be one of the molecular prognostic factors for some cases of gastric cancer. ShRNA can inhibit livin expression in SGC7901 cells and induce cell may serve as a new target for apoptosisinducing therapy of gastric cancer.1. Introduction Gastric cancer is one of the most mon malignancies in the world. Most patients with this disease are diagnosed in advanced stages, and lose the chance of surgical eradication. Despite much progress in chemotherapy, the overall survival of the patients with gastric cancer in advanced stage is still poor. Resistance of cancer cells to chemoagents may contribute to failure of the treatment. Among the reasons of drug resistance, inhibited process of cell apoptosis may play an important role. Cancer cells are often characterized by increased resistance to apoptosis [1], which mediates their increased resistance to various stimuli of cell apoptosis, such as DNA damage, hypoxia, nutrientdeprivation [2,3]. Moreover, apoptosis resistance is considered to be a major cause of therapeutic failure for tumors in clinical practice, since many chemo and/or radiotherapeutic agents function through the induction of apoptotic tumor death [4]. Inhibitor of apoptosis protein (IAPs) is a novel family of intracellular proteins which suppress apoptosis induced by a variety of stimuli [5,6], including viral infection, chemotherapeutic drugs, staurosporin, growth factor withdrawal, and by ponents of the tumor necrosis factora (TNFa)/Fas apoptotic signaling pathways [7168。C9]. The IAPs consists of a group of structurally related proteins with antiapoptotic properties [10], and may play a substantial role in preventing tumor cell from apoptosis, and has bee the focus of research in rece