【正文】 decide identification and bind between RNA polymerase and specific promoter ? repressor： bind operator and repress gene transcription ? activator: bind a special DNA sequence next to promoter advance to bind between RNA polymerase and promoter and to form transcription initiation plex. regulation protein of eukaryotic genes ? transcription factor, it is also transacting factor. ? cisacting protein PB B PA A protein A transacting protein transacting factor protein B cisacting protein transregulation cisregulation RNA polymerase promoter of prokaryotes/eukaryotes effect on RNA polymerase ? The promoter of prokaryotes/eukaryotes is consist of transcriptin initiation site, RNA polymerase identification and binding site and other regulation elements. ? The promoter of eukaryotes is more plicated than that of prokaryotes. ? The sequence of different promoter is certain different. ? The affinity of prokaryotic promoter with RNA polymerase effects directly on frequency of gene transcription initiation ? The affinity between eukaryotic RNA polymerase and promoter is less, when RNA polymerase is single. ? The eukaryotic RNA polymerase can bind with promoter after forming plex with basic transcription factor. regulation proteins effect on activity of RNA polymerase ? Specific promoter decides basic transcription frequency of genes. ? The regulation proteins can change transcription frequency of genes. ? The conformation or the expression level in the cell of regulation proteins gets a change under stimulation of environment signal. DNAprotein and proteinprotein interaction in transcription regulation of eukaryotic genes DNAprotein interaction ? identification and bind between cisacting proteins or transacting factors and cisacting elements ? Its interaction is a noncovalent bond. ? form DNAprotein plex finally proteinprotein interaction ? The most regulation protein can form homodimer, heterodimer, homopolymer or heteropolymer before binding with cisacting element. ? ability of some regulation protein to bind with its cis acting element is increased or decreased after polymerization. ? Some regulation protein don’t bind with DNA, but can effect the activity binding between DNA and other regulation protein by proteinprotein interaction. Section 3 Regulation of prokaryotic gene expression Characters of transcribed regulation in prokaryotic genes Regulation of transcribed initiation in prokaryotic genes Regulation of transcribed termination in prokaryotic genes Regulation of proteic translation in prokaryote characters of transcriptional regulation in prokaryotic genes The function of ? factors ? The ? factors bind a special element in 5’ flaking region of genes in the stage of transcribed initiation ? The ? factors decide the specificity of transcribed genes ? The ? factors mediate holoenzyme of RNA polymerase binding to specific promoter of genes ? Different ? factors decide transcription of different genes. universality of operon model ? the most prokaryotic genes ? There are many operons in order in prokaryotic genome. ? Don’t discover operon in eukaryotic genome. universality of repression mechanism ? The repression mechanism is the main mechanism of transcriptional regulation of prokaryotic genes regulation of transcribed initiation in prokaryotic genes stucture of lactose operon C regulatory region Inhibitor gene Gene Z Gene Y Gene A structural genes region O p 3’ 5’ i gene region 1000bp 100bp 3520bp 760bp 810bp base pair: peptide : (MW kDa) 37 repressor (4 polymer) 32 30 135 ?galactosidase (4 polymer) lactose cell galactose + acetyl CoA acetylgalactose + glucose galactose lactose ? galactoside transacetylase(2 polymer) lactose permease (2 polymer) Catabolite gene activation protein site 10 site 35 site CACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGAGCGGA TAACAATTTCACAC CTCATTAGG ACTCGATTGAGTGTAATTA 5’ 3’ Operon region 20bp RNA polymerase binding region or promoter region Primary structure of lac operon regulation region 5’ TATAAT 3’ Pribnow box z y a i o p repressor (4 polymer) RNA polymerase z y a i o p repressor (4 polymer) RNA polymerase + galactose mRNA regulated mechanism of lac operon genes repressor regulate negatively transcription of lac operon genes catabolite gene activation protein(CAP) regulate positively transcription of lac operon genes CAP site 35 10 1 5’ 3’ RNA polymerase 35 10 CAP cAMP cAMP at glucose absents CAP cAMP CAP + at glucose presents correspond between negative regulation of repressor and positive regulation of CAP in gene transcription control of lac operon CAP site 0 5’ 3’ 35 10 RNA polymerase inhibitor gene glucose concentration is lower and lactose concentration is higher Repressor (4 polymer) + galactose cAMP at glucose absents CAP cAMP CAP + CAP cAMP CAP site 0 5’ 3’ 35 10 RNA polymerase inhibitor gene cAMP at glucose presents CAP cAMP CAP + glucose concentration is higher and lactose concentration is lowe